Ntbbf1arrolb
Web22 nov. 2012 · Abstract. Table S1. Identification of hormone-responsive cis-acting elements within the 5’-region of barley genes potentiated by Pseudomonas fluorescens (strain … WebIn the promoter of the WUS gene of Arabidopsis and its two orthologs in Populus trichocarpa (PopWUS1 and PopWUS2) various auxin sensitive elements were detected: AuxRE, …
Ntbbf1arrolb
Did you know?
Web14 jul. 2024 · Our analysis of osa-miR167 members also found that auxin-responsive CREs (ARFAT, ASF1MOTIFCAMV, CATATGGMSAUR, NTBBF1ARROLB and … Web30 apr. 2024 · Four common cis-regulatory elements, CATATGGMSAUR, ASF1MOTIFCAMV, NTBBF1ARROLB and ARFAT, were found related to plant …
Web15 jan. 2024 · Some cis-elements involved in the regulation of light-controlled genes such as INRNTPSADB, NTBBF1ARROLB and TBOXATGAPB were also part of the deleted … Web1 feb. 2016 · Diversity analysis of maize GH3 genes The GH3 gene family is widely distributed in plant king- dom. GH3 genes have been identified and characterized in …
WebA functional analysis of miR399, a salt-responsive miRNA in the root meristem, indicates the crucial role of this miRNA in modulating soybean root developmental plasticity. Our … Webpssdr1 pscxe1 psat1 cyp82y1 cyp82x1 cyp82x2 cyp719a21 psmt3 psmt2 psmt1 s000042 iro2os cacgtgg s000505 prolaminboxosglub1 tgcaaag s000354 tgtcacacmcucumisin tgtcaca
Web10 nov. 2024 · We chose to focus on three auxin response elements: the AuxRR-core (GGTCCAT), TGA-element (AACGAC), and ntBBF1ARROLB (named BBF) (ACTTTA), …
Web16 apr. 2015 · Furthermore, the SlARF9 promoter sequence contains several NTBBF1ARROLB-elements. These elements were first identified in the promoter sequence of rolB , one of the oncogenes present in the T-DNA sequence of Agrobacterium rhizogenes , and are involved in the auxin-inducible expression of the rolB -gene in plants ( … turck u0885-26Web9 okt. 2014 · -2801 ggctggtttctaagacattttttggtttaatccaaacctaattacaa atatt cccaacaa rootmotiftapox1 -2741 gatcgaatgatctatggctacaaaccctatcccaacaaaaaactacatttagtacatcaa -2681 ... tureckie seriali na russkom osnovanie osmanWeb1 jun. 2009 · We describe the development of a reporter system for monitoring meristem initiation in poplar using promoters of poplar homologs to the meristem-active regulatory genes WUSCHEL ( WUS ) and SHOOTMERISTEMLESS ( STM ). When ~3 kb of the 5′ flanking regions of close homologs were used to drive expression of the GUSPlus gene, … tureckie seriali na russkom iazikeWeb2 mrt. 2024 · One to six (depending on the gene) salicylate-responsive elements (TCA-element, WBOXATNPR1), auxin-responsive elements (TGA-element, NTBBF1ARROLB, gibberellin-responsive elements (MYB, P-box, GARE1OSREP1) and transcriptional repressor of the gibberellin pathway (WRKY71OS) (Figure 2) were also detected. turck ni50u-qv40-ap6x2-h1141Web6 feb. 2024 · Sucrose is an important component of fruit flavor, but whether sucrose signaling affects the postharvest ripening process of kiwifruit is unclear. The aim of this … turco plazaWeb1 jun. 2010 · A prerequisite for biotechnological improvements of storage roots is the availability of tissue-specific promoters enabling high expression of transgenes. In this work, we cloned two genomic fragments, pMe1 and pDJ3S , controlling the expression of a gene with unknown function from cassava ( Manihot esculenta ) and of the storage protein … tureckii seriali na russkom iazikeWeb12 mrt. 2012 · NTBBF1ARROLB: 10: Required for tissue-specific expression and auxin induction; Agrobacterium rhizogenes: SEBFCONSSTPR10A: 3: Similar to the auxin … turck radio